# \[ANN\] BioRecordsProcessing.jl - Process your biological records with ease

**URL:** <https://discourse.julialang.org/t/ann-biorecordsprocessing-jl-process-your-biological-records-with-ease/99929>\
**Category:** Package Announcements\
**Created:** [June 6, 2023, 9:36am UTC](https://discourse.julialang.org/t/ann-biorecordsprocessing-jl-process-your-biological-records-with-ease/99929 "2023-06-06T09:36:46Z")\
**Posts on this page:** 1\
**Page:** 1

<div class="post-metadata">

**Author:** ![jonathanBieler](https://avatars.discourse-cdn.com/v4/letter/j/82dd89/32.png) [@jonathanBieler](https://discourse.julialang.org/u/jonathanBieler)\
**Post date:** [June 6, 2023, 9:36am UTC](https://discourse.julialang.org/t/ann-biorecordsprocessing-jl-process-your-biological-records-with-ease/99929/1 "2023-06-06T09:36:46Z")

</div>

[BioRecordsProcessing.jl](https://github.com/jonathanBieler/BioRecordsProcessing.jl) aims at processing files containing biological records using a minimum amount of boilerplate. It can be used in place of tools like samtools, vcftools, sektq, etc.

#### Features :

- Read from disk, modify/filter the records (with a user defined function) and write back to disk
- Read or write to memory
- Process whole directories in parallel
- Handle paired files
- Handle compressed files
- Supports VCFs, FASTA/Q, S/BAM (and possibly any Record type that uses the bio record “interface”)

#### Example :

```julia
using BioRecordsProcessing, FASTX, BioSequences

p = Pipeline(
    Reader(FASTX.FASTA, File(filepath)),
    record -> begin
        sequence(LongDNA{4}, record)
    end,
    Collect(LongDNA{4}),
)
run(p)

# output
2-element Vector{LongSequence{DNAAlphabet{4}}}:
 CTTGGCATACTCAAACTCTT
 CTTGGCATACTCAAACTCTT

```

#### Missing features :

I think it would be useful to be able to provide a genomic interval to read from (specially for BAM files) and also to group records based on some user-defined criteria (e.g. read names for pair-end BAM files).