# Specific Domains

**URL:** https://discourse.julialang.org/c/domain/10.md?page=297

[Latest](https://discourse.julialang.org/latest.md) · [Categories](https://discourse.julialang.org/categories.md) · [Tags](https://discourse.julialang.org/tags.md)

**Page:** 298

---

## [How choose which GPU to send the workload to in Flux.jl?](https://discourse.julialang.org/t/how-choose-which-gpu-to-send-the-workload-to-in-flux-jl/16337)

<div class="topic-metadata">

**Author:** [@xiaodai](https://discourse.julialang.org/u/xiaodai)\
**Replies:** 3\
**Last updated:** [March 11, 2022, 4:14pm UTC](https://discourse.julialang.org/t/how-choose-which-gpu-to-send-the-workload-to-in-flux-jl/16337 "2022-03-11T16:14:15Z")

</div>

I have set up a neural network in Flux and I would like to train it on a GPU. HOwever my laptop has two GPUs and one is an onboard GPU so I like to send the workload to the better GPU. But how I choose which GPU to send…

---

## [How to use Flux.stop()](https://discourse.julialang.org/t/how-to-use-flux-stop/77746)

<div class="topic-metadata">

**Author:** [@TheLateKronos](https://discourse.julialang.org/u/TheLateKronos)\
**Replies:** 1\
**Last updated:** [March 11, 2022, 2:14pm UTC](https://discourse.julialang.org/t/how-to-use-flux-stop/77746 "2022-03-11T14:14:54Z")

</div>

I am trying to learn how to use Flux.stop() in a callback. My problem is that as far as I can tell, my call to Flux.stop() has litterally no effect - see the following example: The setup: using Flux x\_train = randn(Flo…

---

## [Generalized additive models in julia?](https://discourse.julialang.org/t/generalized-additive-models-in-julia/10041)

<div class="topic-metadata">

**Author:** [@Ken-B](https://discourse.julialang.org/u/Ken-B)\
**Replies:** 9\
**Last updated:** [March 11, 2022, 12:38pm UTC](https://discourse.julialang.org/t/generalized-additive-models-in-julia/10041 "2022-03-11T12:38:29Z")

</div>

Hi, Is anyone using generalized additive models in julia? I know I can link to pyGAM with PyCall or gam with RCall, but I find both packages don’t scale well. My current dataset is of the order 100million rows. I’m wi…

---

## [JLD2 type compatibility](https://discourse.julialang.org/t/jld2-type-compatibility/77684)

<div class="topic-metadata">

**Author:** [@Alessio\_Bellisomi](https://discourse.julialang.org/u/Alessio_Bellisomi)\
**Replies:** 2\
**Last updated:** [March 11, 2022, 12:37pm UTC](https://discourse.julialang.org/t/jld2-type-compatibility/77684 "2022-03-11T12:37:24Z")

</div>

I am using JLD2 to store some data in struct format, it works great. However some of the objects need to change, as I need to add more members. e.g. struct A n::Int a::String end might become struct A n::…

---

## [Rss description from page body in Franklin](https://discourse.julialang.org/t/rss-description-from-page-body-in-franklin/75936)

<div class="topic-metadata">

**Author:** [@Tamas\_Papp](https://discourse.julialang.org/u/Tamas_Papp)\
**Replies:** 1\
**Last updated:** [March 11, 2022, 8:33am UTC](https://discourse.julialang.org/t/rss-description-from-page-body-in-franklin/75936 "2022-03-11T08:33:29Z")

</div>

I understand that Franklin.jl only adds a page to the RSS feed if the relevant page variable is set (rss for short), which then provides the description. Would it be possible to auto-generate this from the first N words…

---

## [How to promote a factorization?](https://discourse.julialang.org/t/how-to-promote-a-factorization/77715)

<div class="topic-metadata">

**Author:** [@ctkelley](https://discourse.julialang.org/u/ctkelley)\
**Replies:** 5\
**Last updated:** [March 10, 2022, 10:12pm UTC](https://discourse.julialang.org/t/how-to-promote-a-factorization/77715 "2022-03-10T22:12:29Z")

</div>

I’m trying to promote an LU factorization in one precision to a higher precision. The permutation vector does not map correctly and I can’t figure out why. Any ideas? MWE: julia\> A=rand(Float32,3,3); julia\> AF=lu!(…

---

## [Infeasible or unbounded model](https://discourse.julialang.org/t/infeasible-or-unbounded-model/77653)

<div class="topic-metadata">

**Author:** [@dires](https://discourse.julialang.org/u/dires)\
**Replies:** 6\
**Last updated:** [March 10, 2022, 10:04pm UTC](https://discourse.julialang.org/t/infeasible-or-unbounded-model/77653 "2022-03-10T22:04:26Z")

</div>

I got this message for my optimization problem can anybody help me how to resolve this? "Result index of attribute MathOptInterface.ObjectiveValue(1) out of bounds. There are currently 0 solution(s) in the model. check…

---

## [Data Container like in Matlab Structure Arrays](https://discourse.julialang.org/t/data-container-like-in-matlab-structure-arrays/77691)

<div class="topic-metadata">

**Author:** [@Bozaga\_Murat](https://discourse.julialang.org/u/Bozaga_Murat)\
**Replies:** 5\
**Last updated:** [March 10, 2022, 7:27pm UTC](https://discourse.julialang.org/t/data-container-like-in-matlab-structure-arrays/77691 "2022-03-10T19:27:01Z")

</div>

Hello everybody, I am master student in simulations in germany. I am newcomer from Matlab because the performance of Matlab is too low for my discretization in the additive manufactaring. Julia is really nice, but I ha…

---

## [Distributed Julia in the cloud](https://discourse.julialang.org/t/distributed-julia-in-the-cloud/77627)

<div class="topic-metadata">

**Author:** [@niczky12](https://discourse.julialang.org/u/niczky12)\
**Replies:** 18\
**Last updated:** [March 10, 2022, 4:06pm UTC](https://discourse.julialang.org/t/distributed-julia-in-the-cloud/77627 "2022-03-10T16:06:13Z")

</div>

I know that JuliaPro is doing a good job of running Julia across a cluster in Azure. However, I have not seen an easy to follow guide to spin up a cluster in AWS/GCP/Azure without the paid version. I am really fed up wi…

---

## [Access the xticks of a Plots.jl plot](https://discourse.julialang.org/t/access-the-xticks-of-a-plots-jl-plot/77676)

<div class="topic-metadata">

**Author:** [@TheLateKronos](https://discourse.julialang.org/u/TheLateKronos)\
**Replies:** 1\
**Last updated:** [March 10, 2022, 9:31am UTC](https://discourse.julialang.org/t/access-the-xticks-of-a-plots-jl-plot/77676 "2022-03-10T09:31:36Z")

</div>

How can I access the current xticks of a figure created by Plots.jl?

---

## [Lanczos tridiagonalization algorithm in Julia?](https://discourse.julialang.org/t/lanczos-tridiagonalization-algorithm-in-julia/77085)

<div class="topic-metadata">

**Author:** [@falbarelli](https://discourse.julialang.org/u/falbarelli)\
**Replies:** 19\
**Last updated:** [March 10, 2022, 7:15am UTC](https://discourse.julialang.org/t/lanczos-tridiagonalization-algorithm-in-julia/77085 "2022-03-10T07:15:29Z")

</div>

Hi everyone! I have been looking for an implementation of Lanczos algorithm in Julia, but to my surprise I haven’t found anything obvious! I need the actual tridiagonalization, i.e. the tridiagonal matrix T and the uni…

---

## [Any way to achieve the L2 norm of a matrix xx is smaller than 1 in JuMP?](https://discourse.julialang.org/t/any-way-to-achieve-the-l2-norm-of-a-matrix-xx-is-smaller-than-1-in-jump/77660)

<div class="topic-metadata">

**Author:** [@zlq178](https://discourse.julialang.org/u/zlq178)\
**Replies:** 3\
**Last updated:** [March 10, 2022, 3:22am UTC](https://discourse.julialang.org/t/any-way-to-achieve-the-l2-norm-of-a-matrix-xx-is-smaller-than-1-in-jump/77660 "2022-03-10T03:22:41Z")

</div>

I want to achieve the constraint: norm(A) \<= 1, where A is a matrix variable. M = Model(SCS.Optimizer) @variable(M,A\[1:3,1:3\]) @constraint(M, \[1; A\] in SecondOrderCone()) But it shows error：@constraint(M, \[1; A\] in Se…

---

## [Extract start and end positions from a PairwiseAlignment](https://discourse.julialang.org/t/extract-start-and-end-positions-from-a-pairwisealignment/77610)

<div class="topic-metadata">

**Author:** [@rohan.m](https://discourse.julialang.org/u/rohan.m)\
**Replies:** 6\
**Last updated:** [March 10, 2022, 3:02am UTC](https://discourse.julialang.org/t/extract-start-and-end-positions-from-a-pairwisealignment/77610 "2022-03-10T03:02:03Z")

</div>

Hello, I am dealing with PairwiseAlignments of the form: PairwiseAlignment{LongDNASeq, LongDNASeq}: seq: 2 TGTCTTTCGCTGCTGAGGGTAGA 24 | | | | | | | | | | | | | | | | | | | | | | ref: 307 TGTCTTTCGCTGC…

---

## [Best way to convert a generic QCQP into standard form in JuMP](https://discourse.julialang.org/t/best-way-to-convert-a-generic-qcqp-into-standard-form-in-jump/77593)

<div class="topic-metadata">

**Author:** [@Shuvomoy\_Das\_Gupta](https://discourse.julialang.org/u/Shuvomoy_Das_Gupta)\
**Replies:** 4\
**Last updated:** [March 9, 2022, 11:46pm UTC](https://discourse.julialang.org/t/best-way-to-convert-a-generic-qcqp-into-standard-form-in-jump/77593 "2022-03-09T23:46:55Z")

</div>

Dear All, I am solving nonconvex quadratically constrained quadratic optimization problems (QCQPs) in JuMP+Gurobi for teaching a recitation class on power system course at MIT (I am a teaching assistant for the course).…

---

## [MPI.jl test\_io\_shared failing](https://discourse.julialang.org/t/mpi-jl-test-io-shared-failing/77530)

<div class="topic-metadata">

**Author:** [@RonRahaman](https://discourse.julialang.org/u/RonRahaman)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 8:02pm UTC](https://discourse.julialang.org/t/mpi-jl-test-io-shared-failing/77530 "2022-03-09T20:02:19Z")

</div>

Hi all, I’m testing my MPI.jl build, which has been built with the cluster’s MPI library (OpenMPI 3.1.6 compiled with GCC 8.3.0). The tests (\]test MPI) succeed except for test\_io\_shared. The error message is below. I …

---

## [How to use ElectronDisplay to display table](https://discourse.julialang.org/t/how-to-use-electrondisplay-to-display-table/77648)

<div class="topic-metadata">

**Author:** [@realkrantz](https://discourse.julialang.org/u/realkrantz)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 6:19pm UTC](https://discourse.julialang.org/t/how-to-use-electrondisplay-to-display-table/77648 "2022-03-09T18:19:44Z")

</div>

\#This works: julia\> using VegaLite, VegaDatasets, ElectronDisplay julia\> dataset("cars") |\> @vlplot(:point, x=:Acceleration, y=:Miles\_per\_Gallon, color=:Origin) #But this does not work: julia\> using DataFrames, Elect…

---

## [How \`JuMP.@expression\` will work ? / Multiple macros](https://discourse.julialang.org/t/how-jump-expression-will-work-multiple-macros/77585)

<div class="topic-metadata">

**Author:** [@iAnkiit](https://discourse.julialang.org/u/iAnkiit)\
**Replies:** 3\
**Last updated:** [March 9, 2022, 6:06pm UTC](https://discourse.julialang.org/t/how-jump-expression-will-work-multiple-macros/77585 "2022-03-09T18:06:26Z")

</div>

I am referring a code in which there are multiple macros with same name. So, how would it work? I mean, what attributes would be called/run when macro is called? eg. @expression(EP, ePowerBalance\[t=1:T, z=1:Z\], 0), @ex…

---

## [Urls in JuMP docs web page giving "404 error page not found"](https://discourse.julialang.org/t/urls-in-jump-docs-web-page-giving-404-error-page-not-found/77639)

<div class="topic-metadata">

**Author:** [@harinreddy](https://discourse.julialang.org/u/harinreddy)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 3:55pm UTC](https://discourse.julialang.org/t/urls-in-jump-docs-web-page-giving-404-error-page-not-found/77639 "2022-03-09T15:55:30Z")

</div>

Hi, Some of the links in: https://github.com/jump-dev/JuMP.jl/blob/master/docs/src/index.md are throwing “404 page not found” error For example: Getting started with Julia Please let me know how to get around this …

---

## [Indirect Connected vertices in a digraph](https://discourse.julialang.org/t/indirect-connected-vertices-in-a-digraph/77631)

<div class="topic-metadata">

**Author:** [@Temi-Tory](https://discourse.julialang.org/u/Temi-Tory)\
**Replies:** 5\
**Last updated:** [March 9, 2022, 2:53pm UTC](https://discourse.julialang.org/t/indirect-connected-vertices-in-a-digraph/77631 "2022-03-09T14:53:58Z")

</div>

Hi guys, This may be an obvious or silly question but I cannot seem to figure out how to do so. I’m not sure how to do this especially for graphs with large number of vertices, where I want to check if there is a path …

---

## [Plots.jl animation issue: dyld: Library not loaded](https://discourse.julialang.org/t/plots-jl-animation-issue-dyld-library-not-loaded/77633)

<div class="topic-metadata">

**Author:** [@gideonsimpson](https://discourse.julialang.org/u/gideonsimpson)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 2:13pm UTC](https://discourse.julialang.org/t/plots-jl-animation-issue-dyld-library-not-loaded/77633 "2022-03-09T14:13:53Z")

</div>

I’ve started having problems with animating with Plots.jl that I previously had no issues with. For the example: using Plots @userplot CirclePlot @recipe function f(cp::CirclePlot) x, y, i = cp.args n = length…

---

## [Medical segmentation framework are you intrested?](https://discourse.julialang.org/t/medical-segmentation-framework-are-you-intrested/77621)

<div class="topic-metadata">

**Author:** [@Jakub\_Mitura](https://discourse.julialang.org/u/Jakub_Mitura)\
**Replies:** 1\
**Last updated:** [March 9, 2022, 1:33pm UTC](https://discourse.julialang.org/t/medical-segmentation-framework-are-you-intrested/77621 "2022-03-09T13:33:23Z")

</div>

Hello I developed medical image viewer plus annotator based on OpenGL \[1\] And set of CUDA accelerated medical segmentation metrics \[2\] Currently I am working on example of using those two with some user defined CUDA.jl…

---

## [Introducing graph computing and programming in Julia](https://discourse.julialang.org/t/introducing-graph-computing-and-programming-in-julia/77629)

<div class="topic-metadata">

**Author:** [@Yadong\_Li](https://discourse.julialang.org/u/Yadong_Li)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 11:07am UTC](https://discourse.julialang.org/t/introducing-graph-computing-and-programming-in-julia/77629 "2022-03-09T11:07:03Z")

</div>

Dear Fellow Julia Developers: I want to share the following introductory blog on graph computing and its enormous potential. Julia is the perfect language for building generic, transparent and scalable graph computin…

---

## [Makie: Mixing "spaces" while plotting](https://discourse.julialang.org/t/makie-mixing-spaces-while-plotting/77581)

<div class="topic-metadata">

**Author:** [@marcpabst](https://discourse.julialang.org/u/marcpabst)\
**Replies:** 6\
**Last updated:** [March 9, 2022, 10:24am UTC](https://discourse.julialang.org/t/makie-mixing-spaces-while-plotting/77581 "2022-03-09T10:24:57Z")

</div>

Hi, I have a quite simple question: Is there currently a way to plot something so that you can specify x and y coordinates in different spaces (i.e. x=10 absolute units; y=0.5 relative units w.r.t. the scene/axis height)…

---

## [How to project a coordinate system on an image?](https://discourse.julialang.org/t/how-to-project-a-coordinate-system-on-an-image/77467)

<div class="topic-metadata">

**Author:** [@matic\_lauko](https://discourse.julialang.org/u/matic_lauko)\
**Replies:** 9\
**Last updated:** [March 9, 2022, 10:16am UTC](https://discourse.julialang.org/t/how-to-project-a-coordinate-system-on-an-image/77467 "2022-03-09T10:16:47Z")

</div>

Hello, I’m trying to create a graph of some cities in Europe, I have tried guessing where cities would be but without much accuracy, and got an idea to just use an image and coordinate system to get direct coordinates an…

---

## [JuMP CPLEX attribute error for getting CPX\_PARAM\_INTSOLLIM](https://discourse.julialang.org/t/jump-cplex-attribute-error-for-getting-cpx-param-intsollim/77595)

<div class="topic-metadata">

**Author:** [@hideakiv](https://discourse.julialang.org/u/hideakiv)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 3:41am UTC](https://discourse.julialang.org/t/jump-cplex-attribute-error-for-getting-cpx-param-intsollim/77595 "2022-03-09T03:41:58Z")

</div>

I am trying to get a CPLEX attribute of a model. I am using JuMP v0.21.10 and CPLEX v0.7.8. using JuMP, CPLEX m = Model() set\_optimizer(m, optimizer\_with\_attributes(CPLEX.Optimizer, "CPX\_PARAM\_INTSOLLIM" =\> 1)) get\_opt…

---

## [Flux. Pooling followed by Dense](https://discourse.julialang.org/t/flux-pooling-followed-by-dense/77394)

<div class="topic-metadata">

**Author:** [@Emmanuel-R8](https://discourse.julialang.org/u/Emmanuel-R8)\
**Replies:** 10\
**Last updated:** [March 9, 2022, 2:44am UTC](https://discourse.julialang.org/t/flux-pooling-followed-by-dense/77394 "2022-03-09T02:44:28Z")

</div>

I am at a loss about the following. I am building a small 2D network where the last 2 layers are a MaxPool followed by a Dense. The parameters to create MaxPool do not care about the size of the input. But the Dense just…

---

## [Makie examples in PortAudio](https://discourse.julialang.org/t/makie-examples-in-portaudio/77614)

<div class="topic-metadata">

**Author:** [@bramtayl](https://discourse.julialang.org/u/bramtayl)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 1:40am UTC](https://discourse.julialang.org/t/makie-examples-in-portaudio/77614 "2022-03-09T01:40:11Z")

</div>

I’m trying to get all of the examples in the PortAudio repo to run as part of CI. I’ve gotten most of the examples to run but I’m struggling with the two examples that use Makie. What I’ve got so far is in this PR: https…

---

## [Bonmin\_jll](https://discourse.julialang.org/t/bonmin-jll/77612)

<div class="topic-metadata">

**Author:** [@Francisco\_Javier\_Mar](https://discourse.julialang.org/u/Francisco_Javier_Mar)\
**Replies:** 1\
**Last updated:** [March 9, 2022, 1:12am UTC](https://discourse.julialang.org/t/bonmin-jll/77612 "2022-03-09T01:12:01Z")

</div>

I got this error message. I am using Bonmin\_jll to solve my model. What can I do? The provided optimizer\_constructor is invalid. It must be callable with zero arguments. For example, "Ipopt.Optimizer" or "() -\> ECOS.Opt…

---

## [Addprocs behavior changed in recent update -- have to enter password now](https://discourse.julialang.org/t/addprocs-behavior-changed-in-recent-update-have-to-enter-password-now/77537)

<div class="topic-metadata">

**Author:** [@chelseas](https://discourse.julialang.org/u/chelseas)\
**Replies:** 2\
**Last updated:** [March 8, 2022, 9:46pm UTC](https://discourse.julialang.org/t/addprocs-behavior-changed-in-recent-update-have-to-enter-password-now/77537 "2022-03-08T21:46:59Z")

</div>

I have passwordless ssh login setup to my server like: ssh csidrane@myserver But then when I go into my terminal and I type: using Distributed addprocs(\[(“myserver”, 1)\]) it used to work just fine! About a month ago…

---

## [Factor of two in Zygote complex gradient](https://discourse.julialang.org/t/factor-of-two-in-zygote-complex-gradient/77545)

<div class="topic-metadata">

**Author:** [@goerz](https://discourse.julialang.org/u/goerz)\
**Replies:** 5\
**Last updated:** [March 8, 2022, 8:14pm UTC](https://discourse.julialang.org/t/factor-of-two-in-zygote-complex-gradient/77545 "2022-03-08T20:14:59Z")

</div>

Either Zygote’s gradients for a scalar function with respect to a complex vector are off by a factor of two, I’ve been doing matrix algebra wrong for the last 10 years, or I’m just being stupid here. Consider the followi…

[Previous page](https://discourse.julialang.org/c/domain/10.md?page=296)

[Next page](https://discourse.julialang.org/c/domain/10.md?page=298)