# Specific Domains

**URL:** https://discourse.julialang.org/c/domain/10.md?no_subcategories=false&page=296

[Latest](https://discourse.julialang.org/latest.md) · [Categories](https://discourse.julialang.org/categories.md) · [Tags](https://discourse.julialang.org/tags.md)

**Page:** 297

---

## [How do I create a PlotTheme with larger fonts in the legend](https://discourse.julialang.org/t/how-do-i-create-a-plottheme-with-larger-fonts-in-the-legend/76877)

<div class="topic-metadata">

**Author:** [@cooperrc](https://discourse.julialang.org/u/cooperrc)\
**Replies:** 3\
**Last updated:** [March 11, 2022, 8:45pm UTC](https://discourse.julialang.org/t/how-do-i-create-a-plottheme-with-larger-fonts-in-the-legend/76877 "2022-03-11T20:45:07Z")

</div>

Greetings, I started using Julia a week ago and I’m documenting my transition from a background in MATLAB + Python to Julia at cooperrc.github.io. I found myself stuck today when I tried to build my own theme and add i…

---

## [Julia implementation of the Interpolate, Truncate, Project (ITP) root finding algorithm](https://discourse.julialang.org/t/julia-implementation-of-the-interpolate-truncate-project-itp-root-finding-algorithm/77739)

<div class="topic-metadata">

**Author:** [@TheLateKronos](https://discourse.julialang.org/u/TheLateKronos)\
**Replies:** 7\
**Last updated:** [March 11, 2022, 7:23pm UTC](https://discourse.julialang.org/t/julia-implementation-of-the-interpolate-truncate-project-itp-root-finding-algorithm/77739 "2022-03-11T19:23:25Z")

</div>

I have been unable to find any real code implementation of ITP method - Wikipedia. However, it claims to be the bee’s knees - just read the first paragraph of the Wikipedia article: “In numerical analysis, the ITP metho…

---

## [Question on Xpress.license function](https://discourse.julialang.org/t/question-on-xpress-license-function/77762)

<div class="topic-metadata">

**Author:** [@Marie](https://discourse.julialang.org/u/Marie)\
**Replies:** 4\
**Last updated:** [March 11, 2022, 6:09pm UTC](https://discourse.julialang.org/t/question-on-xpress-license-function/77762 "2022-03-11T18:09:50Z")

</div>

I am using Xpress and JuMP packages to solve LP problem. First i need to initialize xpress license. There’s a function under Xpress lib.jl: ‘’’ function XPRSlicense(\_i1, \_c1) ccall((:XPRSlicense, libxprs), Cint, (Ptr{…

---

## [Optimal control - minimum time manouvering](https://discourse.julialang.org/t/optimal-control-minimum-time-manouvering/75967)

<div class="topic-metadata">

**Author:** [@FedeClaudi](https://discourse.julialang.org/u/FedeClaudi)\
**Replies:** 5\
**Last updated:** [March 11, 2022, 5:02pm UTC](https://discourse.julialang.org/t/optimal-control-minimum-time-manouvering/75967 "2022-03-11T17:02:39Z")

</div>

Hey everyone, I’m trying to use Julia to solve a non-linear optimal control problem, the “minimum time manouvering” problem for (simulated) race cars (Casanova 2000, Van Koutrik 2015). Briefly, you have a set of differ…

---

## [How choose which GPU to send the workload to in Flux.jl?](https://discourse.julialang.org/t/how-choose-which-gpu-to-send-the-workload-to-in-flux-jl/16337)

<div class="topic-metadata">

**Author:** [@xiaodai](https://discourse.julialang.org/u/xiaodai)\
**Replies:** 3\
**Last updated:** [March 11, 2022, 4:14pm UTC](https://discourse.julialang.org/t/how-choose-which-gpu-to-send-the-workload-to-in-flux-jl/16337 "2022-03-11T16:14:15Z")

</div>

I have set up a neural network in Flux and I would like to train it on a GPU. HOwever my laptop has two GPUs and one is an onboard GPU so I like to send the workload to the better GPU. But how I choose which GPU to send…

---

## [How to use Flux.stop()](https://discourse.julialang.org/t/how-to-use-flux-stop/77746)

<div class="topic-metadata">

**Author:** [@TheLateKronos](https://discourse.julialang.org/u/TheLateKronos)\
**Replies:** 1\
**Last updated:** [March 11, 2022, 2:14pm UTC](https://discourse.julialang.org/t/how-to-use-flux-stop/77746 "2022-03-11T14:14:54Z")

</div>

I am trying to learn how to use Flux.stop() in a callback. My problem is that as far as I can tell, my call to Flux.stop() has litterally no effect - see the following example: The setup: using Flux x\_train = randn(Flo…

---

## [Generalized additive models in julia?](https://discourse.julialang.org/t/generalized-additive-models-in-julia/10041)

<div class="topic-metadata">

**Author:** [@Ken-B](https://discourse.julialang.org/u/Ken-B)\
**Replies:** 9\
**Last updated:** [March 11, 2022, 12:38pm UTC](https://discourse.julialang.org/t/generalized-additive-models-in-julia/10041 "2022-03-11T12:38:29Z")

</div>

Hi, Is anyone using generalized additive models in julia? I know I can link to pyGAM with PyCall or gam with RCall, but I find both packages don’t scale well. My current dataset is of the order 100million rows. I’m wi…

---

## [JLD2 type compatibility](https://discourse.julialang.org/t/jld2-type-compatibility/77684)

<div class="topic-metadata">

**Author:** [@Alessio\_Bellisomi](https://discourse.julialang.org/u/Alessio_Bellisomi)\
**Replies:** 2\
**Last updated:** [March 11, 2022, 12:37pm UTC](https://discourse.julialang.org/t/jld2-type-compatibility/77684 "2022-03-11T12:37:24Z")

</div>

I am using JLD2 to store some data in struct format, it works great. However some of the objects need to change, as I need to add more members. e.g. struct A n::Int a::String end might become struct A n::…

---

## [Rss description from page body in Franklin](https://discourse.julialang.org/t/rss-description-from-page-body-in-franklin/75936)

<div class="topic-metadata">

**Author:** [@Tamas\_Papp](https://discourse.julialang.org/u/Tamas_Papp)\
**Replies:** 1\
**Last updated:** [March 11, 2022, 8:33am UTC](https://discourse.julialang.org/t/rss-description-from-page-body-in-franklin/75936 "2022-03-11T08:33:29Z")

</div>

I understand that Franklin.jl only adds a page to the RSS feed if the relevant page variable is set (rss for short), which then provides the description. Would it be possible to auto-generate this from the first N words…

---

## [How to promote a factorization?](https://discourse.julialang.org/t/how-to-promote-a-factorization/77715)

<div class="topic-metadata">

**Author:** [@ctkelley](https://discourse.julialang.org/u/ctkelley)\
**Replies:** 5\
**Last updated:** [March 10, 2022, 10:12pm UTC](https://discourse.julialang.org/t/how-to-promote-a-factorization/77715 "2022-03-10T22:12:29Z")

</div>

I’m trying to promote an LU factorization in one precision to a higher precision. The permutation vector does not map correctly and I can’t figure out why. Any ideas? MWE: julia\> A=rand(Float32,3,3); julia\> AF=lu!(…

---

## [Infeasible or unbounded model](https://discourse.julialang.org/t/infeasible-or-unbounded-model/77653)

<div class="topic-metadata">

**Author:** [@dires](https://discourse.julialang.org/u/dires)\
**Replies:** 6\
**Last updated:** [March 10, 2022, 10:04pm UTC](https://discourse.julialang.org/t/infeasible-or-unbounded-model/77653 "2022-03-10T22:04:26Z")

</div>

I got this message for my optimization problem can anybody help me how to resolve this? "Result index of attribute MathOptInterface.ObjectiveValue(1) out of bounds. There are currently 0 solution(s) in the model. check…

---

## [Data Container like in Matlab Structure Arrays](https://discourse.julialang.org/t/data-container-like-in-matlab-structure-arrays/77691)

<div class="topic-metadata">

**Author:** [@Bozaga\_Murat](https://discourse.julialang.org/u/Bozaga_Murat)\
**Replies:** 5\
**Last updated:** [March 10, 2022, 7:27pm UTC](https://discourse.julialang.org/t/data-container-like-in-matlab-structure-arrays/77691 "2022-03-10T19:27:01Z")

</div>

Hello everybody, I am master student in simulations in germany. I am newcomer from Matlab because the performance of Matlab is too low for my discretization in the additive manufactaring. Julia is really nice, but I ha…

---

## [Distributed Julia in the cloud](https://discourse.julialang.org/t/distributed-julia-in-the-cloud/77627)

<div class="topic-metadata">

**Author:** [@niczky12](https://discourse.julialang.org/u/niczky12)\
**Replies:** 18\
**Last updated:** [March 10, 2022, 4:06pm UTC](https://discourse.julialang.org/t/distributed-julia-in-the-cloud/77627 "2022-03-10T16:06:13Z")

</div>

I know that JuliaPro is doing a good job of running Julia across a cluster in Azure. However, I have not seen an easy to follow guide to spin up a cluster in AWS/GCP/Azure without the paid version. I am really fed up wi…

---

## [Access the xticks of a Plots.jl plot](https://discourse.julialang.org/t/access-the-xticks-of-a-plots-jl-plot/77676)

<div class="topic-metadata">

**Author:** [@TheLateKronos](https://discourse.julialang.org/u/TheLateKronos)\
**Replies:** 1\
**Last updated:** [March 10, 2022, 9:31am UTC](https://discourse.julialang.org/t/access-the-xticks-of-a-plots-jl-plot/77676 "2022-03-10T09:31:36Z")

</div>

How can I access the current xticks of a figure created by Plots.jl?

---

## [Lanczos tridiagonalization algorithm in Julia?](https://discourse.julialang.org/t/lanczos-tridiagonalization-algorithm-in-julia/77085)

<div class="topic-metadata">

**Author:** [@falbarelli](https://discourse.julialang.org/u/falbarelli)\
**Replies:** 19\
**Last updated:** [March 10, 2022, 7:15am UTC](https://discourse.julialang.org/t/lanczos-tridiagonalization-algorithm-in-julia/77085 "2022-03-10T07:15:29Z")

</div>

Hi everyone! I have been looking for an implementation of Lanczos algorithm in Julia, but to my surprise I haven’t found anything obvious! I need the actual tridiagonalization, i.e. the tridiagonal matrix T and the uni…

---

## [Any way to achieve the L2 norm of a matrix xx is smaller than 1 in JuMP?](https://discourse.julialang.org/t/any-way-to-achieve-the-l2-norm-of-a-matrix-xx-is-smaller-than-1-in-jump/77660)

<div class="topic-metadata">

**Author:** [@zlq178](https://discourse.julialang.org/u/zlq178)\
**Replies:** 3\
**Last updated:** [March 10, 2022, 3:22am UTC](https://discourse.julialang.org/t/any-way-to-achieve-the-l2-norm-of-a-matrix-xx-is-smaller-than-1-in-jump/77660 "2022-03-10T03:22:41Z")

</div>

I want to achieve the constraint: norm(A) \<= 1, where A is a matrix variable. M = Model(SCS.Optimizer) @variable(M,A\[1:3,1:3\]) @constraint(M, \[1; A\] in SecondOrderCone()) But it shows error：@constraint(M, \[1; A\] in Se…

---

## [Extract start and end positions from a PairwiseAlignment](https://discourse.julialang.org/t/extract-start-and-end-positions-from-a-pairwisealignment/77610)

<div class="topic-metadata">

**Author:** [@rohan.m](https://discourse.julialang.org/u/rohan.m)\
**Replies:** 6\
**Last updated:** [March 10, 2022, 3:02am UTC](https://discourse.julialang.org/t/extract-start-and-end-positions-from-a-pairwisealignment/77610 "2022-03-10T03:02:03Z")

</div>

Hello, I am dealing with PairwiseAlignments of the form: PairwiseAlignment{LongDNASeq, LongDNASeq}: seq: 2 TGTCTTTCGCTGCTGAGGGTAGA 24 | | | | | | | | | | | | | | | | | | | | | | ref: 307 TGTCTTTCGCTGC…

---

## [Best way to convert a generic QCQP into standard form in JuMP](https://discourse.julialang.org/t/best-way-to-convert-a-generic-qcqp-into-standard-form-in-jump/77593)

<div class="topic-metadata">

**Author:** [@Shuvomoy\_Das\_Gupta](https://discourse.julialang.org/u/Shuvomoy_Das_Gupta)\
**Replies:** 4\
**Last updated:** [March 9, 2022, 11:46pm UTC](https://discourse.julialang.org/t/best-way-to-convert-a-generic-qcqp-into-standard-form-in-jump/77593 "2022-03-09T23:46:55Z")

</div>

Dear All, I am solving nonconvex quadratically constrained quadratic optimization problems (QCQPs) in JuMP+Gurobi for teaching a recitation class on power system course at MIT (I am a teaching assistant for the course).…

---

## [MPI.jl test\_io\_shared failing](https://discourse.julialang.org/t/mpi-jl-test-io-shared-failing/77530)

<div class="topic-metadata">

**Author:** [@RonRahaman](https://discourse.julialang.org/u/RonRahaman)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 8:02pm UTC](https://discourse.julialang.org/t/mpi-jl-test-io-shared-failing/77530 "2022-03-09T20:02:19Z")

</div>

Hi all, I’m testing my MPI.jl build, which has been built with the cluster’s MPI library (OpenMPI 3.1.6 compiled with GCC 8.3.0). The tests (\]test MPI) succeed except for test\_io\_shared. The error message is below. I …

---

## [How to use ElectronDisplay to display table](https://discourse.julialang.org/t/how-to-use-electrondisplay-to-display-table/77648)

<div class="topic-metadata">

**Author:** [@realkrantz](https://discourse.julialang.org/u/realkrantz)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 6:19pm UTC](https://discourse.julialang.org/t/how-to-use-electrondisplay-to-display-table/77648 "2022-03-09T18:19:44Z")

</div>

\#This works: julia\> using VegaLite, VegaDatasets, ElectronDisplay julia\> dataset("cars") |\> @vlplot(:point, x=:Acceleration, y=:Miles\_per\_Gallon, color=:Origin) #But this does not work: julia\> using DataFrames, Elect…

---

## [How \`JuMP.@expression\` will work ? / Multiple macros](https://discourse.julialang.org/t/how-jump-expression-will-work-multiple-macros/77585)

<div class="topic-metadata">

**Author:** [@iAnkiit](https://discourse.julialang.org/u/iAnkiit)\
**Replies:** 3\
**Last updated:** [March 9, 2022, 6:06pm UTC](https://discourse.julialang.org/t/how-jump-expression-will-work-multiple-macros/77585 "2022-03-09T18:06:26Z")

</div>

I am referring a code in which there are multiple macros with same name. So, how would it work? I mean, what attributes would be called/run when macro is called? eg. @expression(EP, ePowerBalance\[t=1:T, z=1:Z\], 0), @ex…

---

## [Urls in JuMP docs web page giving "404 error page not found"](https://discourse.julialang.org/t/urls-in-jump-docs-web-page-giving-404-error-page-not-found/77639)

<div class="topic-metadata">

**Author:** [@harinreddy](https://discourse.julialang.org/u/harinreddy)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 3:55pm UTC](https://discourse.julialang.org/t/urls-in-jump-docs-web-page-giving-404-error-page-not-found/77639 "2022-03-09T15:55:30Z")

</div>

Hi, Some of the links in: https://github.com/jump-dev/JuMP.jl/blob/master/docs/src/index.md are throwing “404 page not found” error For example: Getting started with Julia Please let me know how to get around this …

---

## [Indirect Connected vertices in a digraph](https://discourse.julialang.org/t/indirect-connected-vertices-in-a-digraph/77631)

<div class="topic-metadata">

**Author:** [@Temi-Tory](https://discourse.julialang.org/u/Temi-Tory)\
**Replies:** 5\
**Last updated:** [March 9, 2022, 2:53pm UTC](https://discourse.julialang.org/t/indirect-connected-vertices-in-a-digraph/77631 "2022-03-09T14:53:58Z")

</div>

Hi guys, This may be an obvious or silly question but I cannot seem to figure out how to do so. I’m not sure how to do this especially for graphs with large number of vertices, where I want to check if there is a path …

---

## [Plots.jl animation issue: dyld: Library not loaded](https://discourse.julialang.org/t/plots-jl-animation-issue-dyld-library-not-loaded/77633)

<div class="topic-metadata">

**Author:** [@gideonsimpson](https://discourse.julialang.org/u/gideonsimpson)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 2:13pm UTC](https://discourse.julialang.org/t/plots-jl-animation-issue-dyld-library-not-loaded/77633 "2022-03-09T14:13:53Z")

</div>

I’ve started having problems with animating with Plots.jl that I previously had no issues with. For the example: using Plots @userplot CirclePlot @recipe function f(cp::CirclePlot) x, y, i = cp.args n = length…

---

## [Medical segmentation framework are you intrested?](https://discourse.julialang.org/t/medical-segmentation-framework-are-you-intrested/77621)

<div class="topic-metadata">

**Author:** [@Jakub\_Mitura](https://discourse.julialang.org/u/Jakub_Mitura)\
**Replies:** 1\
**Last updated:** [March 9, 2022, 1:33pm UTC](https://discourse.julialang.org/t/medical-segmentation-framework-are-you-intrested/77621 "2022-03-09T13:33:23Z")

</div>

Hello I developed medical image viewer plus annotator based on OpenGL \[1\] And set of CUDA accelerated medical segmentation metrics \[2\] Currently I am working on example of using those two with some user defined CUDA.jl…

---

## [Introducing graph computing and programming in Julia](https://discourse.julialang.org/t/introducing-graph-computing-and-programming-in-julia/77629)

<div class="topic-metadata">

**Author:** [@Yadong\_Li](https://discourse.julialang.org/u/Yadong_Li)\
**Replies:** 0\
**Last updated:** [March 9, 2022, 11:07am UTC](https://discourse.julialang.org/t/introducing-graph-computing-and-programming-in-julia/77629 "2022-03-09T11:07:03Z")

</div>

Dear Fellow Julia Developers: I want to share the following introductory blog on graph computing and its enormous potential. Julia is the perfect language for building generic, transparent and scalable graph computin…

---

## [Makie: Mixing "spaces" while plotting](https://discourse.julialang.org/t/makie-mixing-spaces-while-plotting/77581)

<div class="topic-metadata">

**Author:** [@marcpabst](https://discourse.julialang.org/u/marcpabst)\
**Replies:** 6\
**Last updated:** [March 9, 2022, 10:24am UTC](https://discourse.julialang.org/t/makie-mixing-spaces-while-plotting/77581 "2022-03-09T10:24:57Z")

</div>

Hi, I have a quite simple question: Is there currently a way to plot something so that you can specify x and y coordinates in different spaces (i.e. x=10 absolute units; y=0.5 relative units w.r.t. the scene/axis height)…

---

## [How to project a coordinate system on an image?](https://discourse.julialang.org/t/how-to-project-a-coordinate-system-on-an-image/77467)

<div class="topic-metadata">

**Author:** [@matic\_lauko](https://discourse.julialang.org/u/matic_lauko)\
**Replies:** 9\
**Last updated:** [March 9, 2022, 10:16am UTC](https://discourse.julialang.org/t/how-to-project-a-coordinate-system-on-an-image/77467 "2022-03-09T10:16:47Z")

</div>

Hello, I’m trying to create a graph of some cities in Europe, I have tried guessing where cities would be but without much accuracy, and got an idea to just use an image and coordinate system to get direct coordinates an…

---

## [JuMP CPLEX attribute error for getting CPX\_PARAM\_INTSOLLIM](https://discourse.julialang.org/t/jump-cplex-attribute-error-for-getting-cpx-param-intsollim/77595)

<div class="topic-metadata">

**Author:** [@hideakiv](https://discourse.julialang.org/u/hideakiv)\
**Replies:** 2\
**Last updated:** [March 9, 2022, 3:41am UTC](https://discourse.julialang.org/t/jump-cplex-attribute-error-for-getting-cpx-param-intsollim/77595 "2022-03-09T03:41:58Z")

</div>

I am trying to get a CPLEX attribute of a model. I am using JuMP v0.21.10 and CPLEX v0.7.8. using JuMP, CPLEX m = Model() set\_optimizer(m, optimizer\_with\_attributes(CPLEX.Optimizer, "CPX\_PARAM\_INTSOLLIM" =\> 1)) get\_opt…

---

## [Flux. Pooling followed by Dense](https://discourse.julialang.org/t/flux-pooling-followed-by-dense/77394)

<div class="topic-metadata">

**Author:** [@Emmanuel-R8](https://discourse.julialang.org/u/Emmanuel-R8)\
**Replies:** 10\
**Last updated:** [March 9, 2022, 2:44am UTC](https://discourse.julialang.org/t/flux-pooling-followed-by-dense/77394 "2022-03-09T02:44:28Z")

</div>

I am at a loss about the following. I am building a small 2D network where the last 2 layers are a MaxPool followed by a Dense. The parameters to create MaxPool do not care about the size of the input. But the Dense just…

[Previous page](https://discourse.julialang.org/c/domain/10.md?no_subcategories=false&page=295)

[Next page](https://discourse.julialang.org/c/domain/10.md?no_subcategories=false&page=297)